Exercise 19: Polymerase Chain Reaction (PCR)

Introduction

Polymerase Chain Reaction (PCR) is a method used to amplify specific regions of DNA in vitro. In this exercise, PCR will be used to detect the the Green Fluorescent Protein (GFP) gene in transformed Escherichia coli cells. PCR takes place in a small tube containing all of the components needed for DNA synthesis and involves the repeated cycling of temperature in a programmable machine. The reaction includes several temperature steps that are customized specifically for each application (assay). Most PCR assays include 3 main temperature steps called denaturation, annealing and extension. The denaturation step breaks apart the two strands of DNA at 94 °C. The annealing step allows short pieces of DNA (oligonucleotides) called primers to bind on opposite ends of the target region. Primers are designed to bind only to the specific DNA sequences found in the target region that have an exact complementary sequence (in this assay, the primers bind only to sites within the GFP gene, see Table 1.). The two primers should each bind to opposite strands (one to the plus strand and one to the minus strand) and should be oriented in opposite directions. In the extension step, the free 3’ end of each primer will allow the Taq (DNA) polymerase enzyme to extend them by adding dNTPs, in the 5’to 3’ direction, synthesizing new DNA. The extension will create a copy of each target DNA strand defined by the distance between the primers.

In this PCR assay, whole bacterial cells are added to a 50 µl reaction mixture in a 0.2 ml PCR tube. The reaction mixture includes 25 µl of master mix, 5 µl of forward primer, 5 µl of reverse primer, and 15 µl of nuclease-free water. The tube is then placed in a PCR machine. The PCR machine is preprogramed to provide the necessary temperature conditions for denaturation, annealing and extension to take place. After completion of the first cycle the PCR machine repeats the steps for a total of 40 cycles.

Primer sequences (See Table 1. for annealing sites.)

Forward primer 5’ CAG TGG AGA GGG TGA AGG TG

Reverse primer 5’ TGT GGT CAC GCT TTT CGT TG

5’GGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTT3′

Figure 19.1: The pGLO GFP DNA sequence (coding strand) with primer binding sites highlighted in green.

Course Intended Outcomes

Describe and perform at least 3 biochemical tests and describe their roles in microbial identification. Interpret results obtained and draw conclusions from biochemical tests performed.

Collect, organize and present data from an experiment, as well as draw appropriate conclusions and report finding in written form using the scientific method.

Materials Used

Students will work in small groups. Each group will need the following materials for this exercise.

• PCR machine
• Microtubes with master mix and primers and Taq polymerase
• Toothpicks
• Additional materials and cultures will be assigned by your instructor

Procedure, Day 1

Technique:

1. Refer to Exercise 2 for proper use of instruments and aseptic technique.
2. Wear gloves during all molecular procedures to reduce the risk of introducing DNase enzymes or other contaminants to your samples.
3. PCR tubes containing a master mix with primers and enzymes are provided. The PCR tubes should stay on ice at all times until they are placed into the PCR machine.
4. Label the tube with your group number on the top and side using a sharpie marker.
5. Seat the tube in the preheated block on the PCR machine and open the lid. Use caution: Do not to touch the heat block since it is heated to 95˚C.
6. Use a sterile toothpick to touch the center of an isolated colony from your assigned culture plate.
7. Transfer the sample directly to the labeled microtube. Place tip of the toothpick down to the bottom of the tube and twist once. Do not let the sample touch anything other than the inside of the tube.
8. Close the tube cap carefully and dispose of the toothpick in the sharps container.
9. When all groups have labeled and inoculated their tubes the instructor will close the lid and press enter to start the PCR machine.
10. The PCR machine will run for several hours. When it has completed all cycles the lab support staff will remove the samples and store in the refrigerator for use in the next exercise (Exercise 20: Gel Electrophoresis).

Sampling/Inoculation:

1. Your instructor will assign the culture plates to be used for inoculation by your group.
2. Clearly label microtubes on the top and side with your group number.
3. Record your group number and the sample/plate assigned in your lab notebook.

Lab Clean-up

Plates are disposable and should be thrown away in the biohazard container when everyone in the group has completed the exercise.

Disinfect your benchtop and wash your hands before leaving the lab.

Results and Interpretation

1. Complete the table below after confirming results via gel electrophoresis (ex. 20).

Critical Thinking Questions

Did your observed results match your expected results based on the samples used for testing?

What conclusions can you make based on your observed results?